Activation of Phospholipase C 2 by Tyrosine Phosphorylation

Phospholipase C 2 (PLC 2) has been implicated in collageninduced signal transduction in platelets and antigen-dependent signaling in B-lymphocytes. It has been suggested that tyrosine kinases activate PLC 2. We expressed the full-length cDNA for human PLC 2 in bacteria and purified the recombinant enzyme. The recombinant enzyme was Ca -dependent with optimal activity in the range of 1 to 10 M Ca . In vitro phosphorylation experiments with recombinant PLC 2 and recombinant Lck, Fyn, and Lyn tyrosine kinases showed that phosphorylation of PLC 2 led to activation of the recombinant enzyme. Using site-directed mutagenesis, we investigated the role of specific tyrosine residues in activation of PLC 2. A mutant form of PLC 2, in which all three tyrosines at positions 743, 753, and 759 in the SH2-SH3 linker region were replaced by phenylalanines, exhibited decreased Lckinduced phosphorylation and completely abolished the Lckdependent activation of PLC 2. Individual mutations of these tyrosine residues demonstrated that tyrosines 753 and 759, but not 743, were responsible for Lck-induced activation of PLC 2. To confirm these results, we procured a phosphospecific antibody to a peptide containing phosphorylated tyrosines corresponding to residues 753 and 759. This antibody recognized phosphorylated wild-type PLC 2 on Western blots but did not interact with unphosphorylated PLC 2 or with PLC 2 containing mutated tyrosine residues at 753 and 759. Using this antibody, we showed in intact platelets that collagen, a PLC 2-dependent agonist, induces phosphorylation of PLC 2 at Y753 and Y759. These studies demonstrate the importance of these two tyrosine residues in regulating the activity of PLC 2. Most of the regulatory interactions of PLC isozymes are mediated through receptor or nonreceptor tyrosine kinases. The stimulation of PLC 1 has been linked to almost all polypeptide growth factor receptors having intrinsic tyrosine kinase activity (Kamat and Carpenter, 1997; Rhee and Bae, 1997). Upon stimulation, the cytoplasmic domains of growth factor receptors become autophosphorylated on tyrosine residues. This process creates phosphotyrosine binding sites for PLC 1 SH2 domains, resulting in the interaction of PLC 1 with the growth factor receptor and subsequent phosphorylation of the PLC itself. In vivo and in vitro tyrosine phosphorylation of PLC 1 by purified epidermal growth factor or platelet-derived growth factor receptors occurs at analogous tyrosine residues at positions 771, 783, and 1254 (Kim et al., 1991). By substituting phenylalanine for tyrosine at these three sites and expressing the mutant PLC 1 enzymes in NIH/3T3 cells, Kim and colleagues (1991) demonstrated the importance of these residues on the in situ functioning of PLC 1. PLC 1 activity can also be stimulated through the stimulation of a number of other receptors (e.g., T-cell antigen receptor, IgE receptor) which do not themselves possess tyrosine kinase activity but are associated with nonreceptor tyrosine kinases such as Src or Syk. It has been proposed that nonreceptor tyrosine kinases phosphorylate receptors or adapter proteins on tyrosine residues to generate a PLC binding site. Thus they have a role similar to that of the tyrosine receptor kinase’s catalytic domain (Rhee and Bae, 1997). PLC 2 also is phosphorylated on tyrosine residues in response to growth factors and activation of nonreceptor tyrosine kinases. However, much less is known concerning the activation of PLC 2, which is mainly, but not exclusively, found in hematopoietic cells. Platelet-derived growth factor increases the phosphorylation of PLC 2 in rat-2 fibroblasts (Sultzman et al., 1991) and induces the expression of PLC 2 in rabbit vascular smooth muscle cells (Homma et al., 1993). However, it is unclear whether growth factor signaling depends on PLC 2-dependent activation to a major extent. Direct evidence for the importance of PLC 2 in B-cell and platelet function comes from gene knockout studies in which the maturation of B but not T lymphocytes was found to be impaired (Hashimoto et al., 2000; Wang et al., 2000). In addition, signaling through appropriate receptors was found to be defective in both B lymphocytes and platelets. In an attempt to delineate the mechanism of regulation of PLC 2 activity, we expressed enzymatically active recombinant PLC 2 in Escherichia coli and demonstrated its phosThis work was supported by grants from the Southeastern Pennsylvania affiliate of the American Heart Association (to J.L.D.) and HL60683 from the National Institutes of Health (to S.P.K.). F.Ö. was partially supported by a predoctoral fellowship from the Higher Education Council of the Republic of Turkey. ABBREVIATIONS: PLC 2, phospholipase C 2; PCR, polymerase chain reaction; bp, base pair; DTT, dithiothreitol; PIP2, phosphatidylinositol bisphosphate; PAGE, polyacrylamide gel electrophoresis; MOPS, 4-morpholinepropanesulfonic acid; IP3, inositol 1,4,5-trisphosphate. 0026-895X/02/6203-672–679$7.00 MOLECULAR PHARMACOLOGY Vol. 62, No. 3 Copyright © 2002 The American Society for Pharmacology and Experimental Therapeutics 1574/1004900 Mol Pharmacol 62:672–679, 2002 Printed in U.S.A. 672 at A PE T Jornals on A uust 7, 2017 m oharm .aspeurnals.org D ow nladed from phorylation and activation by the recombinant Src-family kinases Lck, Lyn, and Fyn. We also identified the tyrosine residues in the SH2-SH3 linker region of PLC 2 that are involved in the regulation of the enzyme activity of PLC 2. We have shown that phosphorylation of these residues occurs in intact platelets when they are stimulated with collagen. Materials and Methods Materials. Human PLC 2 cDNA containing pMT2 plasmid was a gift from Dr. Joseph Baldassare (Saint Louis University, Saint Louis, MO). Competent DH5 cells (subcloning efficiency) and competent BL21(DE3) cells were purchased from Invitrogen (Carlsbad, CA). The cloning vectors Bluescript KS , pCAL-n, XL-10 Gold ultracompetent cells, and calmodulin affinity resin were from Stratagene (La Jolla, CA). Ready-To-Go T4 DNA ligase was from Amersham Biosciences Inc. (Piscataway, NJ). PIP2 ammonium salt was from Sigma (St. Louis, MO), and [H]PIP2 was obtained from PerkinElmer Life Sciences (Boston, MA). Monoclonal antibody YL 1/2 was from Harlan Bioproducts for Science (Indianapolis, IN). Anti-PLC 2 antibody was a gift from Dr. Graham Carpenter (Vanderbilt University, Nashville, TN). Phosphatase-labeled secondary antibodies and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium membrane phosphatase substrate were from Kirkegaard and Perry Laboratories (Gaithersburg, MD). Synthetic oligonucleotides were obtained from Genosys (Woodlands, TX). PCR products and plasmids were purified using QIAquick Gel Extraction Kit and QIAGEN Plasmid Kit from QIAGEN (Valencia, CA). Restriction enzymes and Wizard Plus Minipreps DNA Purification System were obtained from Promega (Madison, WI). GELCODE Blue staining reagent was from Pierce (Rockford, IL). All other reagents were purchased from Sigma unless otherwise indicated. Glutathione S-transferase–Lck and Fyn tyrosine kinases were gifts from Dr. Alexander Y. Tsygankov (Temple University, Philadelphia, PA). These kinases were produced in Spodoptera frugiperda cells as glutathione S-transferase fusion proteins and purified using glutathione agarose (Lehr et al., 1996). We also used Src-family kinases from commercial sources. Lck and Fyn were from Upstate Biotechnology (Lake Placid, NY) and Lyn was from Sigma. Subcloning of PLC 2 Coding Sequence to pCAL-n. The strategy for subcloning of human PLC 2 into the bacterial expression vector pCal-n included PCR reactions at both ends of the cDNA molecule. These PCR reactions provided appropriate restriction sites for subcloning purposes. For the 5 end PCR reaction, primer 1 (5 -GCTCTAGATCTATGTCCACCACG GTCAAT-3 ), primer 2 (5 -TTCGTCAAGCGGTC3 ), and template DNA in pMT2 were used, and the resultant product was digested with XbaI and EcoRV to generate a 222-bp fragment. Primer 1 (sense) contained XbaI and BglII sites (newly engineered into the noncoding region), and primer 2 (antisense) spanned a stretch beyond the internal EcoRV site that is found at position 291. This fragment, together with the 2716-bp EcoRV, SalI fragment obtained from PLC 2 cDNA, were subcloned into XbaI, SalI digested Bluescript II KS , generating a 5898-bp construct designated PLC 2pBS1. This construct was propagated in DH5 cells. For the 3 end PCR reaction, primer 3 (5 GTCGCCAGCTGCGGCGGCGGCAA-3 ), primer 4 (5 CCCCAAGCTTCTAAAA TTCTTCTGAGTAAAACTTGCTGACTCTCTTCTCTCTTAACCTCTTGTTGACTTTCTCCTGGTACAACTGGA3 ), and template DNA in pMT2 were used, and the resultant product was digested with PvuII and Hind III to generate a 196-bp fragment. Primer 3 (sense) mutated AGGAGG arginine codons to CGGCGG arginine codons at positions 1204 and 1205. Tandem AGG-AGG arginine codons at the amino acid positions 1204 to 1205 were replaced by CGG-CGG arginine codons to allow the protein expression in a bacterial system (Bonekamp and Jensen, 1988). Primer 4 (antisense) contained a DNA sequence encoding a Glu-Glu-Phe epitope tag that is attached to the end of the coding sequence, as well as a Hind III restriction site after the stop codon and C-to-T point mutation to abolish the PvuII site at the position 3699. This 196-bp fragment, together with the 692-bp SalI, PvuII fragment obtained from PLC 2 cDNA in pMT2, were subcloned into SalI, HindIII digested Bluescript II KS , generating a 3848-bp construct designated PLC 2pBS2. Digestion of PLC 2pBS1 with BglII and SalI and digestion of PLC 2pBS2 with SalI and Hind III yielded 3935-bp and 888-bp fragments, respectively. These two fragments were ligated into BamHI and Hind III sites in the polycloning region of pCal-n vector downstream of and in frame with the calmodulin binding protein coding sequence, generating a 9592-bp construct, PLC 2pCAL-n. The presence of the insert was verified with EcoRV digestion. This construct was used to produce a PLC 2 fusion protein containing calmodulin binding peptide at its N-terminal end and the Glu-Glu-Phe tag at its C terminus. The codons for the C-terminal epitope Glu-Glu-Phe was attached to the 3 end of the coding sequence to detect expressed protein with the commercially available monoclonal antibody YL 1/2 (Stammers et al., 1991). Site-Directed Mutagenesis. Mutation of tyrosines Y743, Y753, and Y759 to phenylalanine was accomplished by overlapping PCR (Higuchi et al., 1988). After purification and digestion with SacII and SalI, the resultant mutant PCR product was substituted into the corresponding region of PLC 2pCal-n. The constructs were designated PLC 2pCal-n–Y743/753/759F, PLC 2pCal-n–Y753/759F, PLC 2pCal-n–Y743F, PLC 2pCal-n–Y753F, and PLC 2pCal-n– Y759F. All constructs were sequenced to confirm the mutations. Expression and Purification of Human PLC 2. The pCAL vector-based protein expression and purification system was developed by Zheng and colleagues (1997). When a cDNA is cloned in frame with the calmodulin binding peptide coding sequence, a calmodulin binding peptide fusion protein can be expressed, which can be rapidly purified by chromatography using commercially available calmodulin affinity resin. For bacterial expression of PLC 2, PLC 2pCAL-n–transformed E. coli BL21(DE3) strain was grown in Luria-Bertani medium supplemented with 100 g/ml ampicillin at room temperature and induced with relatively low isopropyl thiogalactoside. Otherwise, PLC 2 was found in inclusion bodies, which were easily purified, but PLC 2 proved difficult to renature. Upon reaching an optical density at 550 nm of 0.8 to 1.0 A.U., the cells were induced with 0.1 mM isopropyl -D-thiogalactoside and were harvested by centrifugation (30 min at 30,000g) after 6 h of induction time. The pellet was resuspended at a concentration of 10 mg/ml in binding buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM DTT, 1 mM magnesium acetate, 1 mM imidazole, 2 mM CaCl2, 1 mM phenylmethylsulfonyl fluoride, 2 g/ml leupeptin, 2 g/ml aprotinin, and 2 g/ml pepstatin A). The resuspended cells were lysed by sonication (5 20 s) while chilled on ice. The lysate was incubated with 1% Nonidet P-40 for 15 min at 4°C, and the cellular debris was formed into pellets by centrifugation (10 min at 10,000g). The supernatant was subjected to calmodulin affinity chromatography. Briefly, calmodulin affinity resin was equilibrated with binding buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM DTT, 1 mM magnesium acetate, 1 mM imidazole, 2 mM CaCl2, 1 mM phenylmethylsulfonyl fluoride, 2 g/ml leupeptin, 2 g/ml aprotinin, and 2 g/ml pepstatin A) and then incubated with the crude E. coli lysate at 4°C for 2 h. After binding, the beads were formed into pellets, and the unbound material was removed. The beads were washed three times with 100 volumes of binding buffer, and the fusion protein was eluted with 3 volumes of elution buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM DTT, 1 mM magnesium acetate, 1 mM imidazole, and 2 mM EGTA). When optimal induction conditions were used, BL21(DE3) cells having this vector expressed the PLC 2 fusion protein at a level of approximately 10 to 20 g/l soluble protein. Recombinant PLC 2 was purified from crude extract to approximately 80% purity after one pass through the calmodulin affinity resin. The recombinant PLC 2 retained its catalytic activity, and its specific activity was 60 nmol/min/mg as determined using PIP2 as the substrate. In Western blots, the major band was recognized as PLC 2 using two different antibodies: antibody YL 1/2 (against the glu-glu-phe epitope tag) (Harlan Bioproducts for Science), and anti-PLC 2 antibody (donated by Dr. Graham Carpenter, Vanderbilt University, Nashville, TN) (data not shown). Regulation of Phospholipase C 2 673 at A PE T Jornals on A uust 7, 2017 m oharm .aspeurnals.org D ow nladed from Preparation of a Phosphospecific Antibody to a Phosphorylated Peptide Containing Residues Y753 and Y759. Phosphospecific antibodies were raised through a commercial contract with Research Genetics (Huntsville, AL). A 13-amino acid peptide (Asn-Ser-Leu-Tyr-Asp-Val-Ser-Arg-Met-Tyr-Val-Asp-Pro) was synthesized using multiple antigenic peptide resin technology (Tam, 1988). The corresponding phosphorylated peptide was prepared by synthesis of a new peptide using phosphorylated tyrosine residues. The resin-linked phosphopeptide was injected into New Zealand White rabbits. The initial injection was followed by two booster injections. Serum was taken, and the antibody was purified by two affinity procedures. The unphosphorylated peptide was used to absorb out antibodies that were not phosphospecific. The doubly phosphorylated peptide was used as an affinity reagent to isolate antibodies specific for doubly phosphorylated PLC 2. SDS-PAGE and Immunoblotting. SDSPAGE was performed according to the procedures described by Laemmli (1970). The gels were either subjected to electrophoretic transfer for immunoblotting or were stained with reagent GELCODE Blue (Pierce) for visualization of the proteins. Electrophoresed SDS-polyacrylamide gels were electrophoretically transferred to Immobilon-P (Millipore Corporation, Bedford, MA). After blocking with 5% nonfat dry milk, blots were incubated with the primary antibody at 25°C for 1 h. Probing of antibody binding was performed by incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibodies. Detection was done by chemiluminescence using SuperSignal (Pierce) with a FujiFilm Las-1000 imaging system (FujiFilm Medical Systems, Stamford, CT). The digitized images were quantified with the use of Image Gauge software (version 3.4; FujiFilm Medical Systems). Alternatively in some experiments, phosphorylated bands were detected and analyzed using the Cyclone phosphoimaging system (PerkinElmer Life Sciences). Assay of PLC 2 Activity. The hydrolysis of Ptd[H]Ins-4,5-P2 was measured in a reaction mixture (50 l) that contained 35 mM NaH2PO4, pH 6.8, 70 mM KCl, 1 mM EDTA, 2 mM MgCl2, 0.6 mM CaCl2 (1 M final Ca 2 concentration), 5 g/ml bovine serum albumin, 5 mM DTT, 200 M Ptd[H]Ins-4,5-P2 (25,000 dpm), 5 mM n-octyl glucoside, and the recombinant PLC 2 purified from E. coli. An aliquot of PLC 2 suspension (5 l) was added to the substrate solution (45 l), and the reaction mixture was incubated at 25°C for the various times. Reactions were stopped by transfer to an ice bath with the addition of 0.5 ml of chloroform/methanol/HCl (100:100:0.6) followed by 0.15 ml of 1 N HCl containing 5 mM EDTA. The aqueous and organic phases were separated by centrifugation, and a 200 l portion of the upper aqueous phase was removed for liquid scintillation counting. Ca dependence was measured in a reaction mixture in which free Ca concentration was adjusted by varying the ratio of CaCl2 to EDTA (see Ca 2 Dependence of Recombinant PLC 2 Activity). In Vitro Kinase Assays. The reactions were performed in in vitro kinase buffer (50 mM MOPS, pH 7.4, 5 mM MnCl2, 5 mM MgCl2, 5 mM DTT). The reactions were started by adding 25 M of ATP (10 Ci of [P]ATP) to a mixture of Src-family kinase and PLC 2, bringing the total volume to 50 l with in vitro kinase buffer. The reactions were carried out at 24°C for the indicated periods of time, and the incorporation of [P]ATP was stopped on ice by adding 4 SDS-PAGE sample buffer. Samples were then analyzed with the use of SDS-PAGE and autoradiography. Autoradiograms were scanned, and the labeled bands were analyzed using the NIH image program (http://rsb.info.nih.gov/nih-image/). Gaussian fit was performed for the quantification of the labeled bands. Ca Dependence of Recombinant PLC 2 Activity. Calcium is necessary for the activity of all mammalian PLC isozymes, and it interacts with several domains of the enzyme including catalytic domain, EF domains, and C2 domain (Katan, 1998). When PIP2 is used as a substrate, low Ca concentrations activate the enzyme, whereas high Ca concentrations inhibit it, creating a peak of catalytic activity as a function of free calcium concentration. Therefore, the Ca concentrations at which the peak occurs can be taken as strong evidence for the correct conformation of the enzyme. To make this measurement, we relied on the Mg -EDTA buffer system described by Wolf (1973). This buffer system has the advantage of being pH-stable. For calibration of our buffers, we used the indicator dye BTC (Molecular Probes, Eugene, OR) and assumed an apparent Kd for Ca 2 of 7 M. The Ca dependence of the activity of recombinant PLC 2 was determined (Fig. 1). We observed that PLC 2 was stimulated by nanomolar concentrations of Ca . The hydrolysis rate increased with increasing Ca concentrations of up to approximately 1 to 10 M and then decreased. The half-maximal stimulation of the enzyme was achieved at 550 nM Ca concentration. Thus, the calcium dependence of the purified recombinant PLC 2 was found to be the same as those reported for PLC 2 purified from platelets (Banno et al., 1990), PLC 1 purified from bovine brain (Wahl et al., 1992; Koblan et al., 1995), and recombinant PLC 1 expressed in bacteria (Koblan et al., 1995), the maximal activity being between 1 and 10 M free Ca concentrations. Note that this and all other assays were performed at 25°C because PLC 2 was much more stable at this temperature. The addition of DTT to the assay buffer also helped to stabilize the enzyme. Preparation of Human Platelets. Human blood was collected from informed healthy volunteers in acid/citrate/dextrose. Plateletrich plasma was obtained by centrifugation at 180g for 15 min at ambient temperature and incubated with aspirin (1 mM) at 37°C for another 45 min. Platelets were isolated from the incubation medium by centrifugation (800g for 15 min, ambient temperature). The final buffer consisted of 137 mM NaCl, 2.7 mM KCl, 2 mM MgCl2, 0.5 mM NaH2PO4, 5 mM glucose, 10 mM HEPES, pH 7.4, 0.2% bovine serum albumin, and 20 g/ml apyrase. The platelet count was adjusted to 2 10 cells/ml.